Review




Structured Review

INTAVIS Inc insitupro vsi robot
Insitupro Vsi Robot, supplied by INTAVIS Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insitupro+vsi/insitupro+vsi+robot/pmc12266118-237-20-23
Average 90 stars, based on 1 article reviews
insitupro vsi robot - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Hybridization:

Article Title: Tissue-specific expression of carbohydrate sulfotransferases drives keratan sulfate biosynthesis in the notochord and otic vesicles of Xenopus embryos.
Article Snippet: .. For Xenopus embryos, automated hybridization experiments were performed with InsituPro VSi (Intavis). .. Stained Xenopus embryos were bleached and observed under a stereomicroscope (Leica M205 FA).

In Situ Hybridization:

Article Title: TRiC activates the unfolded protein response and protects starved stem cells by modulating energy and lipid metabolism during planarian regeneration
Article Snippet: .. Whole-mount in situ hybridization was carried out as described previously ( ) using an InsituPro VSi (Intavis). .. Hapten-labelled RNA probes were prepared by using an in vitro RNA labelling kit (Roche).

Article Title: Genetic risk of cholangiocarcinoma is linked to the autophagy gene ATG7
Article Snippet: .. Automated in situ hybridization using the InSituPro Vsi (INTAVIS, Cologne, Germany) was performed using digoxigenin-labeled riboprobes for atg7 , dlx2 ( distal-less homeobox 2 ), otx2 ( orthodenticle homeobox 2 ), ascl1a ( achaete-scute family bHLH transcription factor 1a ), and fabp10 (fatty acid binding protein 10a, liver basic) . .. Embryos were cleared in 2:1 benzyl benzoate/benzyl alcohol solution and documented using an Olympus SZX12/DP71 imaging system (Olympus Corporation, Tokyo, Japan).

Article Title: Regeneration in starved planarians depends on TRiC/CCT subunits modulating the unfolded protein response
Article Snippet: The following gene‐specific oligos were designed from regions of the gene that were non‐overlapping with the sequence used for dsRNA: SmEf2‐F: 5′‐CAGCCAGTAGCTTTAAGCGATGA‐3′ SmEf2_R: 5′‐ACTCTCAACGCTGCTGTCACTTC‐3′ 5685_qPCR1: 5′‐CTTCAAGTCAAAGCATCATTTACTC‐3′ 5685_qPCR2: 5′‐CATTTCGCAAATCATCTTCTAACTG‐3′ qWi1PPF: 5′‐GCAGAGAAACGGAAGTAATAGAG‐3′ qWi1PPR: 5′‐ATCCAATCCTACAATCATAGTCGG‐3′ xbp1‐QF: 5′‐ATTGGAAACTCCCATTTGTGAC‐3′ xbp1‐QR: 5′‐AGAATTATCTGGCTGACTTTGG −3′ atf6‐QF: 5′‐ TAAGAAATCGAAATTCCGGGAC‐3′ atf6‐QR: 5′‐ AAGCGTATAATCCTTGGTTCTG‐3′ cct3A_QF: 5′‐ GCAATATCAACTCACTTGACCCT‐3′ cct3A_QR: 5′‐ TAACCTTAACACCTTTGCTCCA‐3′ cct4B_QF: 5′‐ CAGAGTTAAGAAATAGACATGCCAG‐3′ cct4B_QF: 5′‐ ACTGTGATTGATAAGGAGTGGT‐3′ cct7_QF: 5′‐ AATTCCACGACAATTATGCGAG‐3′ cct7_QR: 5′‐ CTTCATTAAGAATGTCGACTCCAC‐3′ bip1_QF: 5′‐ATGAAATTGTTCTTGTCGGTGG‐3′ bip1_QR: 5′‐CTGCTTCATCTGGATTAATACCTC‐3′ act_QF: 5′‐GTAGCTCCAGAAGAACATCCAG‐3′ act_QR: 5′‐CAGAAGCATACAAAGACAACACAG‐3′ .. Whole‐mount in situ hybridization was carried out as described previously (González‐Estévez et al , ) using an InsituPro VSi (Intavis). .. Hapten‐labelled RNA probes were prepared by using an in vitro RNA labelling kit (Roche).

Article Title: Biallelic Mutations in Tetratricopeptide Repeat Domain 26 (Intraflagellar Transport 56) Cause Severe Biliary Ciliopathy in Humans.
Article Snippet: This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record.. Please cite this article as doi: 10.1002/HEP.30982 This article is protected by copyright.. All rights reserved DR. RANAD SHAHEEN (Orcid ID : 0000-0002-2590-1759) Article type : Original Biallelic mutations in TTC26 (IFT56) cause severe biliary ciliopathy in humans Ranad Shaheen1,2, Saud Alsahli1, Nour Ewida1, Fatema Alzahrani1, Hanan E Shamseldin1, Nisha Patel1, Awad Al qahtani3 , Homoud Alhebby3, Amal Alhashem4,5, Tarfa Al-Sheddi1, Rana Alomar1, Eman Alobeid1, Mohamed Abouelhoda1,7, Dorota Monies1,7, Abdulrahman Al-Hussaini8,9 , Muneerah A. Alzouman5,Mohammad Alshagrani10, Eissa Faqeih8, Fowzan S Alkuraya1,5,7, 1Department of Genetics, King Faisal Specialist Hospital and Research Center, P.O.

Immunohistochemistry:

Article Title: An open-source semi-automated robotics pipeline for embryo immunohistochemistry
Article Snippet: .. The company Intavus ( https://intavis.com/ ) sells two robots designed for whole-embryo immunohistochemistry: the Insitupro VSi and the Biolane HTI 16Vx. ..

Binding Assay:

Article Title: Genetic risk of cholangiocarcinoma is linked to the autophagy gene ATG7
Article Snippet: .. Automated in situ hybridization using the InSituPro Vsi (INTAVIS, Cologne, Germany) was performed using digoxigenin-labeled riboprobes for atg7 , dlx2 ( distal-less homeobox 2 ), otx2 ( orthodenticle homeobox 2 ), ascl1a ( achaete-scute family bHLH transcription factor 1a ), and fabp10 (fatty acid binding protein 10a, liver basic) . .. Embryos were cleared in 2:1 benzyl benzoate/benzyl alcohol solution and documented using an Olympus SZX12/DP71 imaging system (Olympus Corporation, Tokyo, Japan).



Similar Products

90
INTAVIS Inc insitupro vsi robot
Insitupro Vsi Robot, supplied by INTAVIS Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insitupro+vsi/insitupro+vsi+robot/pmc12266118-237-20-23
Average 90 stars, based on 1 article reviews
insitupro vsi robot - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
INTAVIS Inc immune-robot insitupro vsi ii
Immune Robot Insitupro Vsi Ii, supplied by INTAVIS Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insitupro+vsi/immune+robot+insitupro+vsi+ii/pm39613896-265-28-32
Average 90 stars, based on 1 article reviews
immune-robot insitupro vsi ii - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
INTAVIS Inc insitupro vsi automated immunohistochemistry device
Insitupro Vsi Automated Immunohistochemistry Device, supplied by INTAVIS Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insitupro+vsi/insitupro+vsi+automated+immunohistochemistry+device/pmc11444278-253-36-42
Average 90 stars, based on 1 article reviews
insitupro vsi automated immunohistochemistry device - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results